Review



gibson assembly master mix  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    New England Biolabs gibson assembly master mix
    Gibson Assembly Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 6279 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gibson+assembly/Gibson+Assembly+Master+Mix/pmc12967149-217-24-28
    Average 99 stars, based on 6279 article reviews
    gibson assembly master mix - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Cloning:

    Article Title: Genomic heterogeneity of NAD(P)H dehydrogenase predisposes Cryptosporidium to clofazimine resistance.
    Article Snippet: .. Guide oligo nucleotides (Sigma-Aldrich) were introduced into the C. parvum Cas9/U6 plasmid29 by restriction cloning (see ref. 72 for guide design) and repair templates were constructed by Gibson assembly (New England Biolabs). ..

    Article Title: Metabolic engineering of Methanothermobacter thermautotrophicus ΔH for recombinant acetoin production
    Article Snippet: DNA fragments for cloning were generated via PCR using the Q5 High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA, USA), according to the manufacturer's instructions and subsequently purified using the QIAquick® PCR Purification Kit (Qiagen GmbH, Hilden, Germany). .. Cloning was performed via Gibson assembly using the NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs, Ipswich, MA, USA). ..

    Article Title: Experimental evolution in the cystic fibrosis chemical environment reveals early TCA cycle flux as a central regulator of Mycobacterium abscessus biofilm formation
    Article Snippet: .. The PCR product was then ligated into the linearized vector by Gibson assembly using the NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs). ..

    Construct:

    Article Title: Genomic heterogeneity of NAD(P)H dehydrogenase predisposes Cryptosporidium to clofazimine resistance.
    Article Snippet: .. Guide oligo nucleotides (Sigma-Aldrich) were introduced into the C. parvum Cas9/U6 plasmid29 by restriction cloning (see ref. 72 for guide design) and repair templates were constructed by Gibson assembly (New England Biolabs). ..

    Article Title: Integrative Genomic, Single-Cell, and Functional Profiling of the CD48–CD244 Axis and NK-Cell Dysfunction in Multiple Myeloma
    Article Snippet: Gene fragments encoding murine CD48 (mature and immature isoforms; UniProt P18181), and dCas9-KRAB with a BFP2-mTag reporter were synthesized by Twist Bioscience (South San Francisco, CA). .. Constructs were assembled into lentiviral expression vectors using Gibson assembly (NEB, E2611S) and verified by plasmid sequencing (Plasmidsaurus, South San Francisco, CA). .. Plasmids were amplified in E. coli NEB 5-alpha Competent Cells (High Efficiency; NEB, C2987H) and Stbl3 Competent Cells (Macro Lab, UC Berkeley, CA).

    Plasmid Preparation:

    Article Title: Metabolic engineering of Methanothermobacter thermautotrophicus ΔH for recombinant acetoin production
    Article Snippet: .. Resulting DNA fragments were merged via Gibson assembly using the NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs, Ipswich, MA, USA), yielding the acetoin production plasmid pMVS1111a_P tet _alsSD (deposited at Addgene, plasmid #254143). ..

    Article Title: Divergent CRD-Dependent Mechanisms Govern RAS Isoform-Selective Recruitment of CRAF and ARAF
    Article Snippet: NanoBiT® CMV MCS BiBiT vector, which contains a BRAF N- terminal fused with LgBiT and CRAF N-terminal fused with SmBiT, were purchased from Promega. .. KRAS LgBiT and CRAF SmBiT was generated using the standard Gibson Assembly (NEB HiFi Assembly) using NanoBiT® BiBiT as the vector and following primers: 5’ CTCCGCCCCCCAGCGACACCATAATTACACACTTTGTCTTTG 3’, 5’ CCACAAGTTTATATTCAGTCATGGCGATCGCTAGCTGCAAA 3’, 5’ GGCGATCGCTAGCTGCAAAAAGAACAAG 3’, 5’ TCCGCCCCCCAGCGACAC 3’, and NRAS LgBiT and CRAF SmBiT was generated using the standard Gibson Assembly using NanoBiT® BiBiT as the vector and following primers: 5’ CCTCCGCCCCCCAGCGACACCATCACCACACATGGCAATC 3’, 5’ CACCAGTTTGTACTCAGTCATGGCGATCGCTAGCTGCAAAA 3’, 5’ GGCGATCGCTAGCTGCAAAAAGAACAAG 3’, 5’ TCCGCCCCCCAGCGACAC 3’. ..

    Article Title: Integrative Genomic, Single-Cell, and Functional Profiling of the CD48–CD244 Axis and NK-Cell Dysfunction in Multiple Myeloma
    Article Snippet: Gene fragments encoding murine CD48 (mature and immature isoforms; UniProt P18181), and dCas9-KRAB with a BFP2-mTag reporter were synthesized by Twist Bioscience (South San Francisco, CA). .. Constructs were assembled into lentiviral expression vectors using Gibson assembly (NEB, E2611S) and verified by plasmid sequencing (Plasmidsaurus, South San Francisco, CA). .. Plasmids were amplified in E. coli NEB 5-alpha Competent Cells (High Efficiency; NEB, C2987H) and Stbl3 Competent Cells (Macro Lab, UC Berkeley, CA).

    Article Title: Metabolic engineering of Methanothermobacter thermautotrophicus ΔH for recombinant acetoin production
    Article Snippet: This tetracycline regulatory cassette was flanked by Asc I and Spe I restriction sites, codon-optimized for M. thermautotrophicus , and finally synthesized as a gBlock (Integrated DNA Technologies, Coralville, IA, USA; ). .. The gBlock was subcloned into the pMiniT 2.0 vector and subsequently ligated into pMVS1111a_P hmtB _bgaB via Gibson assembly using the NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs, Ipswich, MA, USA). ..

    Article Title: Experimental evolution in the cystic fibrosis chemical environment reveals early TCA cycle flux as a central regulator of Mycobacterium abscessus biofilm formation
    Article Snippet: .. The PCR product was then ligated into the linearized vector by Gibson assembly using the NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs). ..

    Generated:

    Article Title: Divergent CRD-Dependent Mechanisms Govern RAS Isoform-Selective Recruitment of CRAF and ARAF
    Article Snippet: NanoBiT® CMV MCS BiBiT vector, which contains a BRAF N- terminal fused with LgBiT and CRAF N-terminal fused with SmBiT, were purchased from Promega. .. KRAS LgBiT and CRAF SmBiT was generated using the standard Gibson Assembly (NEB HiFi Assembly) using NanoBiT® BiBiT as the vector and following primers: 5’ CTCCGCCCCCCAGCGACACCATAATTACACACTTTGTCTTTG 3’, 5’ CCACAAGTTTATATTCAGTCATGGCGATCGCTAGCTGCAAA 3’, 5’ GGCGATCGCTAGCTGCAAAAAGAACAAG 3’, 5’ TCCGCCCCCCAGCGACAC 3’, and NRAS LgBiT and CRAF SmBiT was generated using the standard Gibson Assembly using NanoBiT® BiBiT as the vector and following primers: 5’ CCTCCGCCCCCCAGCGACACCATCACCACACATGGCAATC 3’, 5’ CACCAGTTTGTACTCAGTCATGGCGATCGCTAGCTGCAAAA 3’, 5’ GGCGATCGCTAGCTGCAAAAAGAACAAG 3’, 5’ TCCGCCCCCCAGCGACAC 3’. ..

    Expressing:

    Article Title: Integrative Genomic, Single-Cell, and Functional Profiling of the CD48–CD244 Axis and NK-Cell Dysfunction in Multiple Myeloma
    Article Snippet: Gene fragments encoding murine CD48 (mature and immature isoforms; UniProt P18181), and dCas9-KRAB with a BFP2-mTag reporter were synthesized by Twist Bioscience (South San Francisco, CA). .. Constructs were assembled into lentiviral expression vectors using Gibson assembly (NEB, E2611S) and verified by plasmid sequencing (Plasmidsaurus, South San Francisco, CA). .. Plasmids were amplified in E. coli NEB 5-alpha Competent Cells (High Efficiency; NEB, C2987H) and Stbl3 Competent Cells (Macro Lab, UC Berkeley, CA).

    Sequencing:

    Article Title: Integrative Genomic, Single-Cell, and Functional Profiling of the CD48–CD244 Axis and NK-Cell Dysfunction in Multiple Myeloma
    Article Snippet: Gene fragments encoding murine CD48 (mature and immature isoforms; UniProt P18181), and dCas9-KRAB with a BFP2-mTag reporter were synthesized by Twist Bioscience (South San Francisco, CA). .. Constructs were assembled into lentiviral expression vectors using Gibson assembly (NEB, E2611S) and verified by plasmid sequencing (Plasmidsaurus, South San Francisco, CA). .. Plasmids were amplified in E. coli NEB 5-alpha Competent Cells (High Efficiency; NEB, C2987H) and Stbl3 Competent Cells (Macro Lab, UC Berkeley, CA).

    Amplification:

    Article Title: Generation of precise and accurate engineered circRNAs using enzymatic ligation
    Article Snippet: The two DNA halves were amplified separately using Phusion polymerase (NEB #M0530L) followed by an overlap extension polymerase chain reaction (PCR) with a forward primer containing a 5′ T7 promoter overhang. .. The amplified products were cloned into pcDNA3.1 using Gibson assembly (NEB #E2611L). .. Plasmid sequences were confirmed by whole plasmid sequencing (Plasmidsaurus).

    Clone Assay:

    Article Title: Generation of precise and accurate engineered circRNAs using enzymatic ligation
    Article Snippet: The two DNA halves were amplified separately using Phusion polymerase (NEB #M0530L) followed by an overlap extension polymerase chain reaction (PCR) with a forward primer containing a 5′ T7 promoter overhang. .. The amplified products were cloned into pcDNA3.1 using Gibson assembly (NEB #E2611L). .. Plasmid sequences were confirmed by whole plasmid sequencing (Plasmidsaurus).

    Polymerase Chain Reaction:

    Article Title: Experimental evolution in the cystic fibrosis chemical environment reveals early TCA cycle flux as a central regulator of Mycobacterium abscessus biofilm formation
    Article Snippet: .. The PCR product was then ligated into the linearized vector by Gibson assembly using the NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs). ..



    Similar Products

    99
    New England Biolabs gibson assembly master mix
    Gibson Assembly Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gibson+assembly/Gibson+Assembly+Master+Mix/pmc12967149-217-24-28
    Average 99 stars, based on 1 article reviews
    gibson assembly master mix - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    86
    Twist Bioscience gibson assembly
    Gibson Assembly, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gibson+assembly/assembly+gibson/pm42270677-307-33-23
    Average 86 stars, based on 1 article reviews
    gibson assembly - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    99
    New England Biolabs gibson assembly
    Gibson Assembly, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gibson+assembly/Gibson+Assembly+Cloning/pmc12811641-347-11-15
    Average 99 stars, based on 1 article reviews
    gibson assembly - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results